Reverse engineering the euglenoid movement.

نویسندگان

  • Marino Arroyo
  • Luca Heltai
  • Daniel Millán
  • Antonio DeSimone
چکیده

Euglenids exhibit an unconventional motility strategy amongst unicellular eukaryotes, consisting of large-amplitude highly concerted deformations of the entire body (euglenoid movement or metaboly). A plastic cell envelope called pellicle mediates these deformations. Unlike ciliary or flagellar motility, the biophysics of this mode is not well understood, including its efficiency and molecular machinery. We quantitatively examine video recordings of four euglenids executing such motions with statistical learning methods. This analysis reveals strokes of high uniformity in shape and pace. We then interpret the observations in the light of a theory for the pellicle kinematics, providing a precise understanding of the link between local actuation by pellicle shear and shape control. We systematically understand common observations, such as the helical conformations of the pellicle, and identify previously unnoticed features of metaboly. While two of our euglenids execute their stroke at constant body volume, the other two exhibit deviations of about 20% from their average volume, challenging current models of low Reynolds number locomotion. We find that the active pellicle shear deformations causing shape changes can reach 340%, and estimate the velocity of the molecular motors. Moreover, we find that metaboly accomplishes locomotion at hydrodynamic efficiencies comparable to those of ciliates and flagellates. Our results suggest new quantitative experiments, provide insight into the evolutionary history of euglenids, and suggest that the pellicle may serve as a model for engineered active surfaces with applications in microfluidics.

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Control of cell shape by calcium in the euglenophyceae.

The euglenoid flagellates are able to change their shape rapidly in response to a variety of stimuli, or sometimes spontaneously. Two extremes of shape can be identified: the "relaxed" form is cylindrical; the contracted form is a somewhat distorted disc. These 2 forms can be interconverted by treatments that alter the Ca2+ concentration of the entire cell. The level of Ca2+ is believed to be n...

متن کامل

Evolution of the chloroplast genome in photosynthetic euglenoids: a comparison of Eutreptia viridis and Euglena gracilis (Euglenophyta).

The chloroplast genome of Eutreptia viridis Perty, a basal taxon in the photosynthetic euglenoid lineage, was sequenced and compared with that of Euglena gracilis Ehrenberg, a crown species. Several common gene clusters were identified and gene order, conservation, and sequence similarity was assessed through comparisons with Euglena gracilis. Significant gene rearrangements were present betwee...

متن کامل

ASIC design protection against reverse engineering during the fabrication process using automatic netlist obfuscation design flow

Fab-less business model in semiconductor industry has led to serious concerns about trustworthy hardware. In untrusted foundries and manufacturing companies, submitted layout may be analyzed and reverse engineered to steal the information of a design or insert malicious Trojans. Understanding the netlist topology is the ultimate goal of the reverse engineering process. In this paper, we propose...

متن کامل

Considering chain to chain competition in forward and reverse logistics of a dynamic and integrated supply chain network design problem

In this paper, a bi-objective model is presented for dynamic and integrated network design of a new entrant competitive closed-loop supply chain. To consider dynamism and integration in the network design problem, multiple long-term periods are regarded during planning horizon, so that each long-term period includes several short-term periods. Furthermore, a chain to chain competition between t...

متن کامل

Transcriptomic Study Reveals Widespread Spliced Leader Trans-Splicing, Short 5′-UTRs and Potential Complex Carbon Fixation Mechanisms in the Euglenoid Alga Eutreptiella sp.

Eutreptiella are an evolutionarily unique and ecologically important genus of microalgae, but they are poorly understood with regard to their genomic make-up and expression profiles. Through the analysis of the full-length cDNAs from a Eutreptiella species, we found a conserved 28-nt spliced leader sequence (Eut-SL, ACACUUUCUGAGUGUCUAUUUUUUUUCG) was trans-spliced to the mRNAs of Eutreptiella sp...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

ثبت نام

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

عنوان ژورنال:
  • Proceedings of the National Academy of Sciences of the United States of America

دوره 109 44  شماره 

صفحات  -

تاریخ انتشار 2012